Sprinklessussy
Sprinklessussy Sprinklessussy
  • 10-03-2022
  • Biology
contestada

I have 10 minutes left

I have 10 minutes left class=

Respuesta :

jlee01425
jlee01425 jlee01425
  • 10-03-2022

Answer:

The answers you selected are correct

Answer Link

Otras preguntas

Which statement describes an advantage of direct democracy over limited democracy
The role of the president pro temporary of the senate is?
how is multiplying 0.3 by 10 like multiplying 0.3 by 0.01? how is it different?
PLEASE HELP ME...I WILL FAIL}how did the united states justify the expansion of its boundaries to pursue material wealth?
PLEASE HELP FOR 50 POINTS How does a multicellular organism grow larger? A. Its cells shrink in size. B. Its cells rearrange positions, but the number of
The regular price of a CD set is $28.00. The set is on sale for 40% off. What is the amount of the discount?
An ion of an isotope has a 2+ charge, an atomic mass of 56.9397 amu, 2 electrons at the n=4 energy level and 13 electrons at the n=3 energy level. Determine the
Which option most accurately identifies the effect of Confederate inflation on the Southern civilian population? A. He wanted to use Confederate resources to b
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Match the following. Match the items in the left column to the items in the right column. 1. Paul A. one who speaks for, or in behalf of, others 2. willing