ghunderman24 ghunderman24
  • 09-01-2019
  • Chemistry
contestada

What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

Respuesta :

alexandraderigg
alexandraderigg alexandraderigg
  • 09-01-2019
TACCGAACGGTTCCAGGCCTTTCAAAG
Answer Link

Otras preguntas

What is the automated electronic securities market that links sales in the united states, asia, and europe called?
What can push-ups do? Reduce overall bone density Increase amount of cholesterol Increase intensity of back pain Reduce symptoms of arthritis
A(n) _ is a book of synonyms.
What is 7 and 5/9 equal to?
which of the following is true of both DNA and some proteins?
Can you create a scatter plot for this data table? Find a quadratic model for the data. Thanks a bunch.
When you identify the author of a text, which of the following are you are specifically examining in the source? Bias Origin Purpose Agenda PLEASE HELP ME
Who was the first one to read this to cover a abu simbel
What does Mesopotamia mean?
What is 4g 5h when g = 1 and h = 4?