otholloway28 otholloway28

08-02-2021
Mathematics

contestada

If you subtract 14 from twice a number, the result is 6. What is the number?

Respuesta :

hermionegranger59 hermionegranger59

08-02-2021

The equation for this statement:

2x – 14 = 6

=> 2x = 6 + 14

=> 2x = 20

=> x = 20/2

=> x = 10

Answer Link

Otras preguntas

Identify one other factor that impacts climate and describe how it influences climate.

1) Which graph shows different numbers of tickets that Elena can sell to raise more than $180? 2) I would like to know who to mark people the brainiest!!! :)

Part A: If each batch of cupcakes makes 12 cupcakes; how many batches will the bakery need to bake to make 90 cupcakes?

Please help me thanks please

how do you feel after running in the afternoon

A line graph does NOT: a. show trends clearly c. use percentages to display data b. allow viewers to make predictions about data d. show specific values of data

help plz :))))))))))))))))))))))

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

solve the equation y=5x+3,x²-y³+45=0

Which characteristics describe cnidarians? Check all that apply. O Cnidarians are vertebrates. O Cnidarians are invertebrates. O Cnidarians come in a single bod