jls7281 jls7281
  • 08-01-2021
  • Biology
contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer
mathsbeginer mathsbeginer
  • 12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

A 1904 kg car has a speed of 12 m/s when it hits a tree. The tree doesn’t move and the car comes to rest. Find the change in kinetic energy of the car. Answer i
x - 35 > 15 pleases solve
7 1/4 + 5 3/5= reduced to it's lowest form A. 13 3/10 B. 12 17/20 C. 12 7/10 D. 12 11/20 How is this solved?
Rewrite this sentence using a metaphor : Scott was sad for a long time after his puppy dies.
How much time should be allowed for a 605-mile car trip if the car will be traveling at an average speed of 55 miles per hour? A. 9 hours B. 8.75 hours C. 11 ho
what is the least common multiple of 70, 60, and 50?
Write a paragraph using the following words: construct, expand, indicate, reinforce, role, convince, manipulate, avarice, censurer, melancholy, ostentation, per
What is 1/2 ( 2e +5)
how do you divide 50 by 60 and get 85
The least common denominator of two fractions is 28. If you subtract the two denominators, their difference is 10. What are the denominators?