emilyyhornn emilyyhornn

06-05-2020
Mathematics

contestada

Consider the sequence:
6, 10, 14, 18, 22, ...
For this sequence, what is az?
az =

Respuesta :

YKTVDJGOTJOKES YKTVDJGOTJOKES

06-05-2020

Answer:

az=26

Step-by-step explanation:

the sequence rule is add 4

Answer Link

Otras preguntas

an isosceles triangle has angle measures 40°, 40°, and 100° the side across from the 100° angle is 10 inches long how long are the other sidesa. 6.43 inb. 6.53

What happens to the population size when organisms emigrate? A. It remains the same. B. It decreases and then increases. C. It increases. D. It decreases.

PLEASE HELP ILL GIVE BRAINLIEST!!List the sides of ∆DEF in order from shortest to longest if m∠D = 20, m∠E = 120, and m∠F = 40.

BRACK: George Tesman is really an ingenuous creature, Mrs. Hedda. Hedda Gabler; act 3, p. 108 Based on the context of the play and Brack’s own character, as we

Which antebellum social issue was the greatest concern for religious groups such as the Quakers and Moravians? A) public school reform B) the Abolition Moveme

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

Will give brainliest if correct what is the equation of function in slope-intercept form y=mx+b = m=slope = B=Y-intercept =

which of the following sentence is written correctly, A. With whom will you be coming to the party? B. The teacher whom is speaking today is brilliant. C. Wai

I’m pretty confused on this question. Anyone know the answers?

Describe the relationship the French had with Native Americans