amiyahupshaw76543 amiyahupshaw76543

08-03-2018
English

contestada

Why is Iceland called the "land of fire and ice"?

Respuesta :

donavan365 donavan365

08-03-2018

because it has volcanos and it is mostly ice

Answer Link

Otras preguntas

Announcements are a form of Multiple Choice one-to-one communications. one-to-many communications. supervisor-to-subordinate communications. middle-management c

Put the values below into ascending order (smallest to largest). 4%, 2 10⁹ 6 100

You need to move a 117-kg sofa to a different location in the room. It takes a force of 109 N to start it moving. What is the coefficient of static friction bet

What conditions determine which process occurs in a cell?

The total expenses of organizing a party has a fixed expense of $250 as the rent of the place where the party is to be organized and a variable expense dependin

why might the analogy of a quilt have seemed fitting at a time that the nation was suffering from a great trauma?explain

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

The character is portrayed as * (A) self-centered and vain. (B) sentimental and nostalgic. (C) credulous and fervent. (D) desperate and lonely. (E) manipulative

The number of newly reported crime cases in a county in New York State is shown in the accompanying table, where x represents the number of years since 1995, an

write answers only pleaseeeeeeeeeeeeeeeeeeeeeeee fasttttttttt