alyiahschafer alyiahschafer

07-03-2018
Biology

contestada

Which are the reproductive parts of an angiosperm flower?

Respuesta :

ERAmysteriousstudent ERAmysteriousstudent

07-03-2018

pistil,carpel,ovary,ovules

Answer Link

Otras preguntas

Describe maximum parsimony.

is this expression 6(2r+(−1)+1 equivalent to 12r-5

MHC molecules are used for antigen ________ to T cells.

An experiment in which neither the subjects nor the individuals running the study know which subjects are in the control group and which are in the experimental

What is one important style decision that a speaker makes when writing a speech? A. The overall tone of the speech to engage the audience. B. The level of forma

The rate (in cubic feet per hour) that a spherical snowball melts is proportional to the snowball's volume raised to the 2/3 power. (This assumes that the rate

A tax cut shifts the aggregate demand curve the farthest if a. the MPC is large and if the tax cut is permanent. b. the MPC is small and if the tax cut is perma

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Suppose your writing desk is tilted a little. A book kept on it starts sliding down. show the direction of frictional force acting on it. (like maybe in a diagr

Use the following sentence to answer the question. Her sketches are unusual because of their unusual perspective, radical use of color, and she uses unexpected