darlaferrar darlaferrar

08-02-2018
Mathematics

contestada

Which sequences of transformation applied to shape 1 prove that shape 1 is similar to shape 2

Which sequences of transformation applied to shape 1 prove that shape 1 is similar to shape 2 class=

Respuesta :

turtlelife101 turtlelife101

08-02-2018

all it did was shrink in size and move to the square diagonal from it

Answer Link

oklahomamommy23boys oklahomamommy23boys

19-12-2020

Answer:

It dilated by a scale factor of 2

Step-by-step explanation:

Answer Link

Otras preguntas

Brad is getting new carpet for his bedroom. His bedroom is 3 yards wide and 4 yards long. The carpet costs $30 for each square yard. How much will it cost to ca

Is an expansion or extension of the firm by integrating preceding or successive production processes. a) Vertical integration b) Horizontal integration c) Poole

The reaction is first order in both A and B. The reaction may be assumed to be essentially irreversible. The pressure drop along the reactor is negligible. a) E

A nurse is providing community education about peptic ulcer disease caused by helicobacter pylori infection. which statement by the nurse is correct?

What was the purpose of the COP 27 conference that took place in Egypt in November 2021? 1) To discuss ways to combat the climate crisis 2) To promote the use o

Simplify. (6(y-7)(3y+5))/(48(3y+5)) You may leave the numerator and denominator of you

Alguien podría explicarme esto, no se nada de nada y de verdad necesito ayuda. Tengo una prueba mañana y no entiendo ni pío. Explíquenme como niña del kínder qu

A firm can produce q = 0, 1, 2, 3 or 4 units, and the corresponding total cost is TC = 24+2q². at what value(s) of q is p = $18 higher than the firm average tot

Prompt: Students will write a paragraph (4-6 sentences): 1. Give their own definition of a "central idea" in literature. 2. Explain how a central idea is differ

Use the following DNA sequence to answer these questions.Make sure to explain/justify your answers. This piece of DNA is 29 bases long. 5' GACCGATCGGCTAAGCATCAC