colem63 colem63
  • 09-04-2024
  • Mathematics
contestada

This chart shows the number of students, by gender, that play lacrosse.
Boys
Girls
Play
42
12
442
Don't Play
33
23
Find P(plays lacrosse | boy)
Type your answer as a fraction with no spad Ex. "2/3"
type your answer...

Respuesta :

Otras preguntas

why is it important for people to belive that they can grow and develope their own intelligence rather than it being fixed
You are considering creating a mobile app. Describe a basic statement for the app you would create and whether your app should be a free app or a paid app. Supp
find the product. x3(x2+5x+1)
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
PLEASE HELP! What are the steps used to construct a hexagon inscribed in a circle using a straightedge and a compass? Drag the choices to order them correctly.
Identify the genotype for this pedigree chart
Which of the following is a belief of Taoism? A. Harmony can be achieved only through absolute power and control. B. Going with the flow of nature and learnin
n the 1700s, James Watt caused a revolution in transportation by improving
Seven more than the quotient of a number and 3 equals 11
Write and solve a proportion to awnser the question what percent of 25 is 12