skhallskidz skhallskidz

09-05-2022
Biology

contestada

What is the correct numerical sequence for unlocking "DNA Structure?"

Respuesta :

howardclemingtime howardclemingtime

09-05-2022

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Otras preguntas

The Pacific Ocean covers approximately 64,186,300 square miles of Earth’s surface, while the Atlantic Ocean stretches for about 33,420,000 square miles. Express

HELP PLEASE!! When did Georgia officially become a British colony? after the Royal period after the Trustee period at the start of the French and Indian War aft

a square has perimeter of 8 ft. What is the length of each side

find the solution set. |x|= 9 A. { } B. {-3 , 3} C. { -9, 9} D. {-81, 81}

Which of the following statements is consistent with the principle of competitive exclusion?A) Bird species generally do not compete for nesting sites.B) The ra

An iguana at a pet store is 5 feet long. Measurements for iguana cages are given in inches. How many inches long is the iguana?

After the First World War what did the term lost generation refer too

3x + 4y = 12 x + 2y = 10

An orange punch recipe uses 2/3 cup carbonated water for every 4 cups orange juice. Mandy pours 5 cups of orange juice into a bowl.how many cups of carbonated w

which sentence describes an effect of the painting press on the renaissance