atreazure atreazure

09-03-2022
Biology

contestada

What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA class=

Respuesta :

karisoar karisoar

09-03-2022

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Answer Link

Otras preguntas

the earth is the 3rd planet from the sun. it receives just the right amount of heat from the sun, which contributes to the planets life-supporting..?

The delay in implementing which Supreme Court decision helped lead to the protest shown in this photograph?

PLEASE HELP!!!! :C Stephanie has $645 in her savings account, and she wants to use that money to have a great summer. She spends $40 per week on food, clothes,

Randy bought a zero coupon bond and a TIPS 5 years ago for $2,500 each. Both had 10 years to maturity. The TIPS's coupon was 2% while the zero coupon bond will

Which describes the character of King Pluto?

What is the name for animals who live in one spot their whole life?

What are the coordinates of the turning point for the function f(x) = (x − 2)^3 + 1? A. (−2, −1) B. (−2, 1) C. (2, −1) D. (2, 1)

BTW THIS IS PHOTOGRAPHY The flecks of random color in a photograph are called?

What do countries like China, Russia, India, North Korea, Israel, and the United States have in common? A. They are all members of the world court. B. Each c

In order to grow and survive, cells need information from their DNA and nutrients from their environment. When a cell gets too big, however, what does it tend t