lomsolorah245 lomsolorah245

06-02-2022
Biology

contestada

Elements are formed from atoms of the same kind.true or false

Respuesta :

06-02-2022

True

Element : A pure substance composed of the same type of atom throughout.

Answer Link

Otras preguntas

Groups such as the American Bar Association (ABA), with a membership of lawyers and law students, and the American Medical Association (AMA), an association of

x^2-8x-y-4=0 complete the square to find the vertex of this parabola

a doughnut factory can make 1980 doughnuts in 1.5 hr how long would it take to make 6600 doughnuts

If triangle NPZ ~ triangle HBZ find the measure of angle B. Please show the steps

what does a duck say

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

The film strip that emerges from the camera is usually a ______________. That is, its color and light values are the opposite of those in the original scene.

Gillian feeds the goats the same amount of hay each day. On May 3, she has 72 pounds of hay left. On May 5, she has 60 pounds of hay left. Based on the informat

PLS HELP Question 1 Part A Based on the beginning of "To Build a Fire," which inference can be made about the man? A/ He questions his ability to survive the

If one discount point costs the borrower 1% of the loan amount, and increases the lender's yield by 1/8th of one percent, how many discount points must be purch