F1R3Manager
F1R3Manager F1R3Manager
  • 07-12-2021
  • English
contestada

help me guys. pls! maybe .? plssss thoo!!!

help me guys pls maybe plssss thoo class=

Respuesta :

a0163265
a0163265 a0163265
  • 07-12-2021

Answer:

C

Explanation:

Hope this helps!

Answer Link

Otras preguntas

Why do moderate levels of disturbance result in an increase in community diversity? why do moderate levels of disturbance result in an increase in community div
The density of silver is 10.5 g/cm3. A piece of silver that occupies a volume of 42.5 cm3 would have a mass of ________ g.
In the united states, 20 ounces of a beverage that is 25% ethanol contains __________ ounces of alcohol
According to coakley, _______________ is a process of learning and social development, which occurs as we interact with one another and become acquainted with t
In scene 5, Lord Capulet becomes enraged when juliet says she will not marry Paris. In what way are his words and actions in this scene like those of Romeo and
how long should a resume be
During a flu epidemic, 44 students out of the 80 who are in Ms Grant’s class were absent. What percent were absent?
What are the reactants and what is the product of Zn(s)+S(s)->ZnS(s)
The given figure shows the shadow of a tower at midday. In which of these countries is the tower POSSIBLY located? A) Argentina B) Australia C) Brazil D) Ca
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3