Duramax458 Duramax458

10-01-2017
English

contestada

Authors usually intend for the reader to interpret a certain theme from the story.

Respuesta :

LittleBreeze0 LittleBreeze0

10-01-2017

If this is true or false i would say that it is True.

Authors want to be able to put a theme out for everyone to learn from it.

Hope it helps

;D

Answer Link

Аноним Аноним

10-01-2017

i think it is true also i think it is true

Answer Link

Otras preguntas

i got a question. how do u get rid of an addiction ;-;

is WILL BE GOING a A) helping verb B) linking verb C) action verb

andrea rents a bike for 8 hours and pays $42 for the rental tomorrow she wants the same bike but only needs it for 6 hours what equation can she use to figure o

given the segments as shown for what value of x is the figure a rectangle A. 5. B. 7 C. 3 D. 9

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

anyone need point just get it

what is “ what are you doing” in spanish someone text me :( lm.ao party all night, where you going , what you doin <3 ahaha:)

heres some stuff i cant answer,, can yall answer this plz? my mum said i can get a 3080TI if i do good in school so plz answer ):

I need help with this problem

Why would a reader compare a story's futuristic setting to life in the present time?will pay give cash app pls ;] to get through the story’s descriptive details