phuongptn02 phuongptn02
  • 07-09-2021
  • Advanced Placement (AP)
contestada

Giả sử ban đầu nền kinh tế Việt Nam ở tragj thiad cân bằng tại mức sản lượng tiềm năng. Từ năm 2019, nhièu nước bán hàng của Việt Nam lâm vào suy thoái và mua ít hàng của Việt Nam hơn

Respuesta :

peteronso
peteronso peteronso
  • 07-09-2021
cannot understand the language
Answer Link

Otras preguntas

3 is what percent of 23?
3/4 gallon of paint covers 1/3 of the wall then how much paint is needed for the entire wall
"Illa nocte, dum Troiani dormiunt, milites inimici ex equo descendunt et Troia oppugnatur." TRANSLATE from LATIN to ENGLISH please dont use google translate, i
If you are calculating a 15% off discount you need to ___ to know the sale price
if your a Jolly Rancher fan, find 4 different reasons why is is a good candy other than saying it is delicious
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D
This question is on the picture
Quotation marks are a type of punctuation that can be used to indicate___ or ___.
What's equivalent to 2/3?
Armon added 1/10 and 8/100 what is the sum of these fractions