2100525 2100525
  • 08-06-2021
  • Mathematics
contestada

Question is on the screenshot

Question is on the screenshot class=

Respuesta :

xGavin xGavin
  • 08-06-2021
Answer: V= 150π

V= πr^2 h
V= π(5)^2 (6)
V= 150π
Answer Link
noahec1005 noahec1005
  • 08-06-2021
Approximately y=2.94
Answer Link

Otras preguntas

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
expressions equivalent to -2(x-5)
22. The term describes the removal of a body part or the destruction of its function through the use of surgery, hormones, drugs, heat, chemicals, electrocaute
draw a diagram of the structure of the following atoms and state their electron arrangement: (i) 24 Mg 12 (ii)40 Ca 20
The expected value of a normal distribution of prices for a stock is $51. If you are 90 percent sure that the price of the stock will be between $42 and $60, th
There are three section of class 10th in Kendriya Vidyalaya Delhi Cantt the total number of strain in class 10th 400 the marks obtained by the students in pre b
1/4 Ib = ? oz I don’t understand how the fraction can be turned into the answer , I know you have to multiply or divide but I just do not understand this questi
For the current fiscal year, Purchases were $187,000, Purchase Returns and Allowances were $4,200 and Freight In was $10,500. If the beginning merchandise inven
Is the human population growing too fast, or not fast enough?
What characteristics of the face and body show good health?What characteristics show bad health?