masahamad masahamad

09-04-2021
Biology

contestada

Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine the mRNA and amino acid sequence for the below DNA sequence class=

Respuesta :

mariawaelramzy mariawaelramzy

09-04-2021

AUGAGCCCCGCUAGGUUCUC

Answer Link

Otras preguntas

Which of the following strategies would best help a city combat a growing urban heat island? A. raise the electricity usage in city buildings B. eliminate nativ

Two numbers are in a ratio of 7:4 their sum is 220 find the bigger number

The light bulb was an innovation of A. Guglielmo Marconi B. Thomas Edison C. Alexander Graham Bell D. Jean Lenoir E. Gustav Eiffel

name all the angles that are congruent to angle 8

Which describes the United States after the American Civil War? A. two nations, one with slavery and one without B. a united nation with no slavery C. a united

Who was elected president of the Confederate States of America? A. Jefferson Davis B. John C. Calhoun C. Andrew Johnson D. Robert E. Lee

The ratio of schooner to skiffs in the bay is 7 to 5. If there were 63 schooners in the bay, how many skiffs were there?

Two characteristics of the Declaration of Independence include: did not completely sever ties with England listed grievances that occurred after the Stamp Act e

After prime time, television stations broadcast late news and comedy talk shows. How is this supposed to be corrected?

why do some balloons pop when they are left in sunlight for too long