kash03 kash03
  • 07-04-2021
  • Biology
contestada

What does PM stand for?

Respuesta :

Аноним Аноним
  • 07-04-2021

Answer:

Particulate Matter

Explanation:

Answer Link
student22928 student22928
  • 07-04-2021
PM Is for when the sun goes down and it night
Answer Link

Otras preguntas

India changed its policy of sterilizing people to control population in 1996, primarily because the policy __________. A. was popular B. violated human rights C
Original price: $36; Markup: 7.5%
nancy is earned 40.50 raking leaves in two days. she worked 2.75 hours yesterday and 1.75 hours today. if nancy was paid the same amount for every hour she work
You spend 2 hours and 15 minutes commuting to work each day. You work five days per week. How much time do you spend commuting to work each week?
An insertion of the fibularis longus is the __________.
find the solutions to the equation below check all that apply 4x^2+4x+1=0 A. x=-1/2 B. x=1/2 C. x=3 D. x=2 E. x=3/2 F. x=-2
What would happen to a food web if one species were to become extinct ?
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
quotient of 2 1/4 and 5/8?
which of the following is not a type of retail bank? A.bond bank B.private bank C.offshore bank D.ethical bank