braylenaok braylenaok

10-12-2020
Biology

contestada

Transcribe then translate the following
TACCTGTTAAGCTACAAAATT

Answer Choices:
A:Met-Ser-Met-Phe-Asp Acid-Stop
B:Met-Asp Acid- Asp-Ser-Met-Phe-Stop
C:Met-Phe-Asp Acid-Asp-Ser-Met-Stop

Respuesta :

aliallre aliallre

10-12-2020

C: Met-phe-Asp-Acid-Asp-Ser-Met-Stop

Answer Link

Otras preguntas

The activity a cell performs is called

Find the reciprocal of each fraction 2/5

Rising demand for tobacco in Europe during the colonial period was responsible for _______ (PLEASE HELP)

Which of the following do groups of different tissues form? A) organ B) organelle C) organ system D) organism

How to convert .34 repeating as a fraction

Why do all ecosystems depend on producers?

What is the point-slope form of the equation of a line that passes through the point (6, −8) and has a slope of −2?

A guitar string vibrates with a frequency of 256hz. What is the period of vibration

Calculate the magnitude of the horizontal vector that is 100 units long and is oriented at 45 degrees

Which equation would best help solve this problem?Five added to 4 times a number is equal to 9 less than 2 times the number. A.9x + 2 = 5x + 4 B.5x + 4 = 9x