nathnanielsanchez72 nathnanielsanchez72

10-11-2020
English

contestada

please help plxx you will get brainlist if your right (if there is two answers)

please help plxx you will get brainlist if your right if there is two answers class=

Respuesta :

gilmore12591 gilmore12591

10-11-2020

Answer:

yur answer is c i got it rite

Answer Link

Otras preguntas

How was the land politically divided in Ancient Greek civilization

In a population of ladybugs, a change in DNA of the offspring of one bug produces entirely black bugs. These bugs are more successful in escaping predators. Ove

How would you handle new team members if you were an IT manager?

Arturo hires Kate to work in new sporting goods store. "Look," he explains, "I can only pay you $9.00 per hour. But if business is good a year from now, and you

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that

Please someone help me with the right answer help me find the area of this polygon

n 1849, Francis Parkman wrote, “The buffalo supplies the Indian with the necessities of life…” In what ways did the buffalo do this?

. Which social theory views high schools as organizations having a distinctive elite orientation in the educational opportunities available for students from di

An agronomist wishes to estimate, to within one percentage point, the proportion of a new variety of seed that will germinate when planted, with 95% confidence.

Break-even analysis for a service company involves identifying the correct measure of a.direct labor for the unit of analysis. b.activity for the unit of analys