fabiolapedroza16
fabiolapedroza16 fabiolapedroza16
  • 10-11-2020
  • Mathematics
contestada

What is the factorization of 2x^2 + 7x + 6?

Respuesta :

Hrishii
Hrishii Hrishii
  • 10-11-2020

Answer:

( x + 2)(2x + 3)

Step-by-step explanation:

[tex]2 {x}^{2} + 7x + 6 \\ \\ = 2 {x}^{2} + 4x + 3x + 6 \\ \\ = 2x(x + 2) + 3(x + 2) \\ \\ = ( x + 2)(2x + 3)[/tex]

Answer Link

Otras preguntas

Could y’all pls help out brainlest correct answer only
What does the Nightingale do at the end of stanza I?
?? anyone know thank you
A quantity with an initial value of 6200 decays continuously at a rate of 5.5% per month. What is the value of the quantity after 4 years, to the nearest hundre
Possessive adjective or pronoun? Mine is a pink cup over there. PLZ HELP
Can someone help me please
Cases that involve federal law usually start in which type of court? A. U.S. District Court B. State trial court C. State appellate court D. U.S. Court of Appea
AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of
what caused the end of middle kingdom
NEED ANSWER ASAP Which type of Symbiotic Relationship is described below? When two organisms interact with one another and one is benefited, and one isn't bene