Chickennuggiesss Chickennuggiesss

07-10-2020
Mathematics

contestada

Pls help me answer this question if correct I'll make brainylist!!!!

Pls help me answer this question if correct Ill make brainylist class=

Respuesta :

matthew236549 matthew236549

07-10-2020

Answer:

y = 4.25x

Step-by-step explanation:

Y (total cost) = 4.25(cost of cheese) times x(number of cheeses)

Answer Link

Otras preguntas

A cylinder has a volume of 198 cm3, and its base has an area of 22 cm2. What is the height of the cylinder? V= πr²h

Weigh 10 grams of sugar and then dissolve in 100 mL of water (2 tools).

PLEASE I NEED HELP URGENTLYA long-distance phone company charges $4.95 month plus an additional $.10 per minute. a. Define a variable and write a formula to fin

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

How did agriculture shape the economy and culture of Texas?

In ΔTUV, the measure of ∠V=90°, VT = 45 feet, and TU = 90 feet. Find the measure of ∠T to the nearest degree.

these are answers Use the algebra tiles to model x – 3. Then complete the statements. The variable is represented by ✔ one orange x tile Subtracting three is r

If there were 1,593 Ronald McDonald's in the McDonald's, how many could fit?

PLEASE HELP!! Revise the following essay so that it’s more appropriate for the task, purpose, and audience describe in the prompt. Prompt: Write and argumentat

Can someone please help me. i'll give a brainliest Write a compete sentence using these verbs 1 - Yo (hacer) ..... 2 - Yo (poner) ..... 3 - Yo (salir) ..... 4