sam76768
sam76768 sam76768
  • 10-06-2020
  • English
contestada

What condition threatens peetas life

Respuesta :

ericmorales71212
ericmorales71212 ericmorales71212
  • 10-06-2020

Answer:

blood poisoning

Explanation:

from a cut he got

Answer Link

Otras preguntas

The divide between the Communist Soviet Union and Democratic western countries was called the "________" by British Prime Minister Winston Churchill. A) Steel
HELP ASAP 16 points List civilizations on the Silk Road.
John wants to find the center of a wall so he can hang a picture. He measures the wall and determines it is 65.25" wide. 65.25" is what type of data? Quantitat
An ice cream cone has a radius of 3 inches and a height of 9 inches. What is the exact value of the volume of the ice cream cone? 27π in3 81π in3 9π in3 3π in3
Gasoline is a molecule wich consist of
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
Name all the central angles. ∠​ROU, ∠​UOT ∠URO, ∠​RUO, ∠​UTO, ∠​TUO ∠​RUT, ∠​UTS, ∠​TSR, ∠​SRU ∠​ROU, ∠​UOT, ∠​ROT
find the inverse of f(x)=2x+9
How does the narrator feel immediately after he commits the murder? Do his feelings change? If so, how and why in Tell-Tale Heart
Find the equation of the axis of symmetry and the coordinates of the vertex of the graph of the function: y =2x2+12x+13