06-05-2020
Computers and Technology

contestada

What needs to happen to your website for your site to be seen publicly?

Respuesta :

sageni7399 sageni7399

06-05-2020

Answer:

It needs to be publicly hosted on a web server.

Explanation:

Answer Link

Otras preguntas

Eli takes a typing test and types all of 300 words in 1/10 hour. He takes the test a second time and types the words in 1/12 hour. Was he faster or slower on th

the selling price of 25/4 kg of apples is rs.400 .at what rate per kg are the apples being sold?

How can you determine the difference between an arithmetic and geometric sequence if you are given the first 4 terms of the sequence?

Unit 4 quiz engineering and technology

the supplement of angle t is 4 times the measure of angle t

what is the answer to a,b,c,d,e

What did the British promise in exchange for Indian Nationalist backing during WWI? acknowledgement of the INC greater self-governance full Independence end to

Two clear solutions are placed in separate beakers. The first solution has a pH of 4, and the pH of the second solution is unknown. If the two solutions are mix

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Hey can you please help me posted picture of question