justinap444
justinap444 justinap444
  • 07-04-2020
  • Biology
contestada

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Respuesta :

aleecha107
aleecha107 aleecha107
  • 07-04-2020

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

Answer Link

Otras preguntas

what happens once in a lifetime, twice in a moment, but never in one hundred years?
94% of salmon pass through a single dam unharmed. By what percent does the number of salmon decrease when passing through a single dam? The number of salmon dec
What is the most correct first step to solve the following system by substitution?
What were the working conditions for these people?
The equation a + b = c could be true or false. a . If a is 3, b is 4, and c is 5, is the equation true or false? b . Find new values of a, b, and c that make t
What did the moutain men look for is the west
Organic rice cost twice as much per pound as conventional rice at a bug food store. Select all of the graphs that could represent the prices of rice at the stor
HELP! PLEASE SOLVE THIS FOR ME!!!!
6. Solve by factoring: 2x²-11x+14=0
You are the administrator of an annual essay contest scholarship fund. This year a $84,000 college scholarship is being divided between the top two contestants