saira72 saira72

07-04-2020
History

contestada

How does Roosevelt attempt to boost the moral of the American people

Respuesta :

07-04-2020

Answer:

Explanation:

His goal was to improve peoples lives and suffering so he created the New Deal.

Answer Link

Otras preguntas

Select the correct answer. Star Wars was the name given to which Reagan effort? A. Nuclear Arms Disarmament B. Nuclear Arms Race C. Strategic Defense Initiat

Only answer if you’re sure :) id like the full equation! Will give Brainly

Which of the following can be a reason why it's difficult to interpret primary sources? O A. Poor grammar B. Difficult-to-read handwriting C. Bad spelling D. Al

Pleasee helpp.... I don't know this...

Definition of Anthropometry about food and nutrition

A certain pickup truck gets 14 mpg in the city and 21 mpg on the highway. If the driver drives 220 mi on 12 gal of gas, determine the number of city miles and h

Select the number where a semicolon is needed. The tornado was rapidly approaching 1 the town 2? no warning 3 had been given 4 to the unsuspecting residents. is

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Digby's Elite product Dim has an awareness of 72%. Digby's Dim product manager for the Elite segment is determined to have more awareness for Dim than Andrews'

13. Oriole Corp. incurred $750,000 of research and development costs to develop a product for which a patent was granted on January 2, 2015. Legal fees and othe