caggh345 caggh345

09-12-2019
Mathematics

contestada

State the inequality that represents this graph??? Please helpppppp

State the inequality that represents this graph Please helpppppp class=

Respuesta :

09-12-2019

Answer:

y>(2/3)x+4

Step-by-step explanation:

Also, use demos graphing calculator to help with graphs

Answer Link

Otras preguntas

How many recursive subproblems are solved by the merge sort algorithm applied to a sequence of n elements? 1) 2⁽ⁿ/²⁾ 2) n/2 3) 2ˡog_2(n) - 1 4) 2ⁿ - 1

Use the accompanying graph to estimate the value of y when x = 2.5 and x = 7.

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Article Review: Effects of Cultural Space on International Business Interactions from year 2023-2024 The contents are:- introduction abstract background objecti

Solve Exponential equation x=3⁶ˣ-2=(1/9)ˣ+1

Two bodies A and B of mass 1kg and 2kg , respectively,are dropped near the Earth's surface . Let the acceleration of A and B be a'and a'' respectively then1) a'

A scientific technique can be used to determine the presence and concentration of a chemical compound in a sample. A light source is directed at samples of know

1 Select the correct answer. How does the key idea in paragraph 7 connect to paragraph 6? ○ A. B. ○ C. by providing an explanation for why some wildlife behavio

Unless the chromosomes were stained to show band patterns, a karyotype would be least likely to show which of the following? a) Gender of the individual b) Gene

Cylinder with the same volume difrent measurements