kyleadler0807 kyleadler0807

07-12-2019
Biology

contestada

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Respuesta :

Milliecartier Milliecartier

07-12-2019

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

Answer Link

Otras preguntas

I need help solving this

Two angles are supplementary. One angle measures 16 degrees less than 3 times the other. Find the measure of each angle.

What does feminine influence mean? Aunt Alexandra said it in To Kill A Mockingbird.

If a woman is homozygous for type A blood and her husband is type O, what is the probability that their offspring would have any one of the 4 possible blood typ

If I have 4 moles of a gas at a pressure of 5.6 atm and a volume of 12 liters, what is the temperature?

Consider five circles with a radii of 1, 2, 4, 8, and 16 inches. Write your answer in terms of pi r square. Compare the areas and circumference of a circle when

Consider five circles with a radii of 1, 2, 4, 8, and 16 inches. Write your answer in terms of pi r square. Compare the areas and circumference of a circle when

Two angles are supplementary. One angle measures 16 degrees less than 3 times the other. Find the measure of each angle.

On what date did Columbus sail the ocean blue

What are 3 causes of the boston tea party and 3 effecwhat are 3causes and effects of the boston tea party