10-05-2016
History

contestada

What was an immediate result of the Great Leap Forward?(1958)

Respuesta :

Insidious Insidious

10-05-2016

Hey there!

The Great Leap Forward increased shortage of food in China. It had unfortunately killed over 20 million people.

Thank you!

Answer Link

MrJsDaughterOfChaos MrJsDaughterOfChaos

16-11-2019

a decline in production of agricultural and manufactured goods

Let me know if this helped!

Answer Link

Otras preguntas

What is the answer? Please and thanks

Dots sells a total of 284 T shirts ($2) shorts ($4) April ($676) How many T shirts and Dots sell Hint let S =shorts

Which object has the greater density? A piece of wood with a mass of 15 grams and a volume of 10 cubic cm or a rock with a mass of 20 grams and a volume of 15 c

15 points going to brainliest! Scientists have discovered convection currents inside Earth. Explain how these convection currents move and what layer(s) they oc

Is 16 the same as (-2) to the 4th power

Write a recorded telephone greeting for your family's home phone

What is the air we breathe made up of? What is the most common element in it? Why is air consider a mixture?

adam smiths laissez-faire theories are most closely associated with

what is a production possibility curve

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand