emmalwarford
emmalwarford emmalwarford
  • 09-07-2019
  • Mathematics
contestada

Given that ABC ~ DEF, if EF = 7.5 what is the length of ?



6.5
6
5
5.5

Given that ABC DEF if EF 75 what is the length of 65 6 5 55 class=

Respuesta :

zdomi
zdomi zdomi
  • 09-07-2019

Answer:

5

Step-by-step explanation:

The triangles have a 2:3 ratio given by the heights of the triangles. We can assume the sides of the triangles must always form a 2:3 ratio with the sides. 5:7.5 forms 2:3 ratio if you divide 5/7.5. This equals .67, just as 2/3 does.

Answer Link

Otras preguntas

What does Powhatan tell Smith to send back after Smith’s release?
I suggest that Sid play the guitar at tonight’s performance. subjunctive not subjunctive
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
All real numbers less than or equal to 2 and greater than or equal to 1
Ron walks 0.5 mile on a track in 10 minutes. Stevie walks on the track in 6 minutes. Find the unit rate for each walker in miles per hour. Who is the fastest wa
would an earthquake support the principle of uniformitarianism or the principle of catastrophism
Tim mixed 2 parts vinegar and 5 parts water to make a cleaning liquid. How many parts of vinegar did Tim mix with each part of water? A) 1/10 B) 1/5 C) 2/7
In recent studies, ___________________ was the most widely used illicit drug by drivers who "drug and drive."
Find the following expression by multiplying. (a + b)^2
how is this person able to stay on the skateboard