MuazamaNoor MuazamaNoor

07-04-2019
English

contestada

Choose this words to complete the sentences above: addict(s) / addicted / addictive

Choose this words to complete the sentences above addicts addicted addictive class=

Respuesta :

blakevid blakevid

07-04-2019

1. addict

2. addicted

3. addicts

4. addictive

5. addicted

6. addicted

Answer Link

ryanmorse01 ryanmorse01

07-04-2019

addict, addicted, addicts, addictive, addicted, addicted

Answer Link

Otras preguntas

What type of sentence might include a coordinating conjunction A simple sentence A compound sentence A complex sentence A compound complex sentence

Clara simplifies (8b-4r)-(2b-r) and says the result is 6b-5r. What error did Clara make? HELP ASAP ONLY HAVE 15 MINS LEFT

How many integers between 1-100 are divisible by 3 or 5 or 7?

Lisa had to draw 4trees for every flower she drew if she draws 90 plants in all how many will be flowers

The photograph below was taken during construction of the Panama Canal:Public DomainWhat does this photograph demonstrate about the construction of the Panama C

Hemolytic disease of a new born is caused by a ___________________ type of hypersensitive reaction. a. immune complex b. cell-mediated c. anaphylactic d. cytoto

Mia is at the movies, which is located at (9, 3) on a coordinate grid. If she wants to go to her dance class located at (3, 1), which route could Mia take? Assu

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What principle does the US Supreme Court apply when it declares an act of congress unconstitutional?

last one help me please