uzzmarcus uzzmarcus
  • 06-02-2019
  • History
contestada

why does each state need its own constitution

Respuesta :

evazquez
evazquez evazquez
  • 06-02-2019

The country is divided into states and the Constitution allows states many powers. Each state then has to run itself and each state has the power to write its own state constitution. So basically if a state has a constitution, then the state has it's own self set of rules or powers.

Answer Link

Otras preguntas

If x varies directly as y, and x = 48 when y = 16, find x when y = 5. A) 5/3 B) 153.6 C) 15
Most progressives wanted to break up _____ and regulate large companies
Which of the following is an example of social facilitation? A. The football player who practices hard so he can be on the varsity team B. The Olympic bic
What is (x-5)1/2+5=2
Which river marked the clearest boundary between slave and free states in 1860?
If 29.0 l of methane, ch4, undergoes complete combustion at 0.961 atm and 140c, how many liters of each product would be present at the same temperature and pre
El alumno ____________________ una composición con un bolígrafo. (escribir)
About how many people in the world die each year due to starvation?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Which type of poem contains EXACTLY 17 syllables? A) an epic B) a haiku C) a ballad D) a sonnet Eliminate