07-12-2018
English

contestada

What has a tongue but cannot talk, gets around but cannot walk

Respuesta :

07-12-2018

its probably a snake

Answer Link

AestheticPerson AestheticPerson

07-12-2018

I remember being asked this

The answer is

A Shoe

-May

Answer Link

Otras preguntas

____________ is the process by which a group of workers legally take away a union's right to represent them. disqualification decertification impeachment disenf

At the level of cabinet appointees president obama worked with limited success to

What is one reason postman believes television is a myth in current culture? a.because tv offers experiences that normal society will never personally experienc

Q # 13 please Graph the image. of AMOP for the translation

During a flu epidemic, 44 students out of the 80 who are in Ms Grant’s class were absent. What percent were absent?

which of the following was not a contributing factor to the great depression

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

PLZ HELP!!! *best answer gets brainliest*

what are 2 examples of materials that cells must enter or leave in order for a cell to survive?

write the proper word equation to express the following chemical reaction: 3Li (s) + AuCI3 (aq) -> 3LiCI (aq) + Au(s)