INEEDMATHELP456 INEEDMATHELP456
  • 10-09-2018
  • Mathematics
contestada

how do you write the decimal expansion for 6/11

how do you write the decimal expansion for 611 class=

Respuesta :

wolf1728
wolf1728 wolf1728
  • 10-09-2018

Divide 6 by 11

6 / 11 = 0.5454545455

Answer is A


Answer Link
brodtfamily4
brodtfamily4 brodtfamily4
  • 10-09-2018

The answer is simply A. Hope thish helps!

Answer Link

Otras preguntas

40 BIG DADDY POINTS What is the definition of situational irony? A) a situation in which an author makes fun of human flaws and imperfections B) a situation
Based on the character description, what can the reader infer about Ruth
Use rounding to estimate the product. 8.24 × 5.88
Fill in the coefficients that will balance the following reaction: HClO4 + Pb(NO3)3 →Pb(ClO4)3 +HNO3
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
It is less expensive to purchase 12 hours of recording time at the studio or a $750 music software program that you can use to record on your own computer expla
Can someone help me develop an idea
5xt5=5+5x answer and show steps
What is the recursive formula for this geometric sequence with this explicit formula?
Identify the italicized part of the sentence. An interrogative sentence is a sentence that asks a question. subject predicate direct object indirect object pre