johnjones12314 johnjones12314

08-05-2018
Mathematics

contestada

A roof rises 9 feet for every 12 feet of run. What is the slope of the roof?

A.) -3
B.) 3
C.) 3/4
D.) 4/3

Respuesta :

Аноним Аноним

10-05-2018

the answer is C.3/4
Hope this helps!

Answer Link

Otras preguntas

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

rachel uses grid paper to plan a mural to paint at her school. the design will be made of two connected rectangles. the larger rectangle will have an area betw

The gastroenteric reflex stimulates motility __________. along a few feet of the small intestine along the sigmoid colon along the entire length of the small in

A square poster has a side length of 26 in. Drawn on the poster are four identical triangles. Each triangle has a base of 8 in. and a height of 8 in. Children p

Mary Warren might be seen as the foil for Abigail. Explain how she is used to bring out Abigail’s traits

use redeem in a sentence

In 1931, the__________ invasion of Manchuria persuaded the Chinese ____________Party and the warlords to unite with the Kuomintang to defeat the foreign enemy.

during world war 2 the federal government allocated millions of dollars. for child care programs throught the U.S. because

Definition: One of a class of elements having properties intermediate to metals and nonmetals.

Ethyl acetate is a sweet-smelling solvent used in varnishes and fingernail polish remover. it is produced industrially by heating acetic acid and ethanol togeth