hawkswoopergami hawkswoopergami
  • 08-05-2018
  • Mathematics
contestada

What value of k will cause the following equation to have exactly 1 root? 16x^2-24x+k=0

Respuesta :

rzafra2002 rzafra2002
  • 08-05-2018
256x-24x+k=0
232x+k=0
Answer Link

Otras preguntas

Semi easy-which boxplot represent the 5 number summary
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
Which of the following equations will be the graph of a parabola? y = 5x + 12 y = x^2 - 2x + 3 3x^5 - 6x^3 + 4x + 12 y = 2 ⋅ 3^x
Si en una caja con 500 huevos se quebraron o estrellaron 100. ¿Qué porcentaje de huevos se quedó sin dañar
the most correct definition of a chemical bond is the:​
Las células en los tejidos epiteliales están fuertemente unidas a la lámina basal. ¿Qué tipo de proteínas están involucradas en este tipo de unión célula-matriz
Students and adults purchased tickets for a recent school play. All tickets were sold at the ticket booth (discounts of any type) were not allowed. Student tick
Guys pls help me!!!!!!!!!
What happened to religion in West Africa when islam was introduced
How are exponents and roots related? ​