86bspq49qm 86bspq49qm
  • 09-05-2024
  • History
contestada

After the American
Revolution, why was the
United States of America in
debt?
A. The U.S. had just purchased the
Louisiana Territory.
B. The U.S. owed money to countries like
France and Spain.
C. The U.S. had to pay Great Britain back
for the war.

Respuesta :

Otras preguntas

aiden opens a savings account with a deposit of 4,500. the account pays 3% simple interest. if aoden does not make any more deposits or withdrawls, how much mon
1. Light waves are one type of ____________ wave. mechanical electromagnetic 2. Sound is an example of a ____________ wave. mechanical electromagnetic 3. A
. Use the three-point general rubric to evaluate the paragraph. Different Types of Plants There are many different type of plants. Some plants are tall, Some i
help its super easy but having trouble
14:56 in it simplest form
How to make a summary
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
percy jackson is scared of what in chapter 7 of book 1 ?
Write an equation in slope-intercept form for the line that has a slope of -4/5 and passes through (5, 10)
Solve for x. log x + log 3 = log 18 Enter your answer in the box.