mikkidee13681 mikkidee13681

08-02-2024
Biology

contestada

A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.
TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT
Which strand of DNA is transcribed and in which direction?

Respuesta :

Otras preguntas

A committee consisting of 3 faculty members and 5 students is to be formed. Every committee member position has the same duties and voting rights. There are 7 f

How important do you think education is in life and why ( 200 words )

HURRY!!!! Which equation is quadratic in form?

How many times does 3/8 go into 3/16?

can someone help please!! i’ll give brainliest

Every jump a game piece makes measures 8/9 . The piece starts at point A = 3 and jumps to the right. As soon as the piece jumps over B = 60, it switches direct

How do you find the volume of a cylinder with these dimensions Diameter 25cm Height 7cm

which set of statements explain how to plot a point at the location

Jefferson believed that the United States should remain an agricultural nation. a. True b. False

Working in the yard does not help achieve health benefits. True or False