andriiaiaiaiaiaa andriiaiaiaiaiaa
  • 06-02-2024
  • Mathematics
contestada

how to leave answer in minutes and seconds?

how to leave answer in minutes and seconds class=

Respuesta :

Otras preguntas

If jeremy gives his horse 12 gallons of water each day. How many one quart pails of water is that
In which of the following ways did slaves commit sabotage
When the third customer came in with an expired coupon, the waitress flew {on} the handle. A. NO CHANGE B. from C. off D. over
Suppose you want to organize a community watch, one from each street. you have 5 volunteers from maple street and 3 volunteers from elm street. how many permuta
When and why did the us enter ww2?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
answer and explanation thanks
A system of writing in which pictorial symbols represented sounds, syllables, or concepts, and was used for official and monumental inscriptions in ancient egyp
Radiation requires a heated liquid to transfer energy. Please select the best answer from the choices provided T F
A steady supply of _________ is needed throughout the body in order for electrons to be accepted at the end of the electron transport chain.