TheLegendYT TheLegendYT

11-01-2024
Biology

contestada

This is a question about Biology, I need help
Pls answer the Best as you can

Write the base pairs that go on the opposite strand
BUILD A DNA STRAND
(remember the base pairs)

TTAAGCGGTTAAGCATTGCGGGCAAT

Respuesta :

Otras preguntas

Which answer adds an adverb phrase to this sentence? Dinner is almost ready, so please put your phone away. A. Dinner is almost ready, so please put your p

Research by harry and margaret harlow (1966) suggests that

How can loss of biodiversity affect human health?

HURRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRY Quantum physicists are scientists who study the inner workings of atoms. To do this, quantum physicists

The ________ is the basis for all telecommunications signals

Need help!!! 1-3 will give the brainiest!!!!

How did america transform from an elite group into a more democratic nation?

If sales tax in your city is 4.4 and an item cost 3$ before tax how much tax would you pay on that item?

If x = 1 is a zero of the polynomial function f(x) = 3x3 − 8x2 + 3x + 2, which of the following is another zero of f(x)?

A company's employee database includes each employee's compensation. a) is this variable discrete or continuous? b) what are the possible values it can tak