natynatito26 natynatito26
  • 08-11-2022
  • Mathematics
contestada

operaciones convinadas con desarrollo

a) (12-7-8+1) * (-3)=
b) (-72+24-48-12):(+3)=
c) (-45-18+15) : (-6) =

Respuesta :

Otras preguntas

A 12-foot ladder is leaning against a wall. The distance from the base of the wall to the base of the ladder is feet. Given this information, what can be deter
The weather patterns seen on earth are influenced greatly by a. Constant motion of the tech tonic plates b. Strength and direction of earths magnetic field c. A
(10 POINTS) What is the importance of ecosystems in West Africa?
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Which battle marked the end of hostilities during the revolution?
Which battle marked the end of hostilities during the revolution?
Marcia is caring for her husband, andrew, who suffers from advanced alzheimer's disease. she has accepted her role as andrew's caretaker willingly and without h
Q # 9 Find the circumference
Which statement about the Chernobyl disaster is NOT true? Despite radiation dangers, 600,000 workers, mostly soldiers, worked to clean up the accident. Radiatio
What is the size of the angle in the shaded triangle marked by the arrow